Table 1

Clinical and histopathological data, results of immunohistochemistry, p53 sequencing, and microsatellite analyses in 25 advanced gastric carcinomas

Clinical data
Sex: f, female; m, male. Survival status: 0, censored; 1, death. Localisation: ca, cardia; co, corpus; an, antrum. Histopathological classification according to Lauren29: i, intestinal type; d, diffuse type. Regression score according to the Japanese Research Society for Gastric Cancer classification of gastric carcinoma30: 0, grade 0; 1a, grade 1a; 1b, grade 1b; 2, grade 2; 3, grade 3. p53 immunohistochemistry: 0, negative; 1, positive (nuclear expression in >10% of tumour cells). BAX immunohistochemistry: 0, negative; 1, positive (cytoplasmatic expression in >5% of tumour cells). Allelic status of p53 mutation: het, heterozygeous; hemi, hemizygeous.
    Patient ID12345678910111213141516171819202122232425
    Sexffmmfmffmfmfmfmmfffmmmmmm
    Age at diagnosis (years)57496246614251463245554748494443443354504056603436
    Overall survival (months)12.35.550.117.720.86.28.17.49.511.812.64.914.512.34.213.3529.66.912.6316.711.619.74.7
    Survival status1101011111111111111110101
    Resection1011100001111111010111010
Histopathological data
    Localisationcoanco/ancacocoananancoanco/ancoco/anancaanancoancoancococa
    Lauren classificationdddiiddiddddiididddddiddd
Histological regression
    Regression score003330000321a1b21a1b030223030
Immunohistochemistry
    p531011100101111000010101110
    BAX0001001101101100010000101
Microsatellite analysis
    Mononcleotide markers
    BAT25
    BAT26
    Dinucleotide markers
    APCLOHLOHLOHLOHLOHLOHLOHLOHLOH
    D17S250LOH
    D2S123MSIMSIMSIMSI
    Pentanucleotide marker
    TP53.AlkLOHLOHLOHLOH
Sequencing results
    p53 mutation0011100100011000000100010
    Exon58586565
    Codon177282162273213175220178
    Wild-type sequenceCCCCGGCGCCGTCGACGCTATGCC
    Nucleotide substitutionTCCCTGCCCTGTCCACACTGTGAC
    Allelic status of p53 mutationhethethethethethethethet